Review



l-glutamic acid monosodium salt hydrate (monosodium glutamate, msg, g5889  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Millipore l-glutamic acid monosodium salt hydrate (monosodium glutamate, msg, g5889
    L Glutamic Acid Monosodium Salt Hydrate (Monosodium Glutamate, Msg, G5889, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/msg+(l-glutamic+acid+monosodium+salt+hydrate/l+glutamic+acid/pmc10224201-201-12-24
    Average 90 stars, based on 1 article reviews
    l-glutamic acid monosodium salt hydrate (monosodium glutamate, msg, g5889 - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: All-Electrical Ca 2+ -Independent Signal Transduction Mediates Attractive Sodium Taste in Taste Buds.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-GFP (clone JL-8) Clontech Cat#632381; RRID:AB_2313808 Goat anti-tdTomato SICGEN Cat#AB8181-200; RRID:AB_2722750 Rabbit anti-RFP Rockland Immunochemicals Cat#600-401-379; RRID:AB_2209751 Rabbit anti-P2X2 SIGMA Cat#P7982; RRID:AB_261187 Sheep anti-NTPDase2 R&D systems Cat#AF5797; RRID:AB_10572702 Guinea pig anti-mouse CALHM1 Taruno et al., 2017 N/A Chick anti-GFP Aves Labs Cat#GFP-1010; RRID:AB_2307313 Rabbit anti-TRPM5 Alomone Labs Cat#ACC-045; RRID:AB_2040252 Donkey anti-mouse IgG, Alexa Fluor 405-conjugated Abcam Cat#ab175659; RRID:N/A Donkey anti-mouse IgG, Alexa Fluor 488-conjugated Thermo Fisher Scientific Cat#A21202; RRID:AB_141607 Donkey anti-chick IgY, Alexa Fluor 488-conjugated Jackson ImmunoResearch Cat#703-546-155; RRID:AB_2340376 Donkey anti-goat IgG, Alexa Fluor 546-conjugated Thermo Fisher Scientific Cat#A11056; RRID:AB_142628 Donkey anti-rabbit IgG, Alexa Fluor 546-conjugated Thermo Fisher Scientific Cat#A10040; RRID:AB_2534016 Donkey anti-guinea pig IgG, Biotin-conjugated Millipore Cat#AP193B; RRID:AB_92668 Donkey anti-rabbit IgG, Alexa Fluor 488-conjugated Thermo Fisher Scientific Cat#A21206; RRID:AB_2535792 Chemicals, Peptides, and Recombinant Proteins Potassium chloride (KCl) Wako Cat#163-03545 Quinine hydrochloride (QHCl) Nacalai tesque Cat#29910-74 Denatonium benzoate SIGMA Cat#D5765 Citric acid monohydrate (Citric acid) Nacalai tesque Cat#09654-35 Sucrose Wako Cat#196-00015 L-glutamic acid monosodium salt hydrate (MSG) SIGMA Cat#G5889 Amiloride hydrochloride hydrate SIGMA Cat#A-7410 L-glutamic acid monopotassium salt hydrate (MPG) SIGMA Cat#G-1501 Inosine 50-monophosphate disodium salt hydrate (IMP) SIGMA Cat#I-4625 Furosemide SIGMA Cat#F4381 Barium chloride (BaCl2) SIGMA Cat#B-0750 1,2-Bis(2-Aminophenoxy)ethaneN,N,N’,N’-tetraacetic acid (BAPTA) SIGMA Cat#A4926 Carbenoxolone disodium salt SIGMA Cat#C4790 2-N-morpholino-ethane sulfonic acid (MES) Nacalai tesque Cat#02442-44 Streptavidin, Alexa Fluor 647-conjugated Thermo Fisher Scientific Cat#S21374 Sodium chloride (NaCl) Wako Cat#191-01665 (Continued on next page) Neuron 106, 1–14.e1–e6, June 3, 2020 e1 ..

    other:

    Article Title: Characterization of Non-Specific Uptake and Retention Mechanisms of [ 177 Lu]Lu-PSMA-617 in the Salivary Glands
    Article Snippet: The sulforhodamine B (SRB) based In vitro toxicology assay kit (TOX6) and L-glutamic acid monosodium salt hydrate (monosodium glutamate, MSG, G5889) were purchased from Sigma-Aldrich (Overijse, Belgium).

    Article Title: Superoxide dismutase reduces monosodium glutamate-induced injury in an organotypic whole hemisphere brain slice model of excitotoxicity.
    Article Snippet: Sample preparation for lactate dehydrogenase (LDH) cytotoxicity After slices rested overnight, supernatant was collected (time t = − 3 h) and replaced with SCM containing 1– 1000 mM MSG (L-glutamic acid monosodium salt hydrate, Sigma), 1000 mM NaCl (sodium chloride, Sigma), or 100 ng/mL LPS (lipopolysaccharide O111:B4, Sigma) for disease induction, if applicable.

    Article Title: Cellular and neural responses to sour stimuli require the proton channel Otop1
    Article Snippet: Taste solutions used for glossopharyngeal nerve recordings are: Saccharin 20mM (Sigma, 8.17042), L-Glutamic acid monosodium salt hydrate (MSG) 100mM (Sigma, G5889), inosine 5’-monophosphate (IMP) 1mM (Sigma, PHR1475), quinine hydrochloride dihydrate (QHCl) 0.3mM (Sigma, 1596807), NH4Cl 100mM (Sigma, 11209), NaCl 100mM (Sigma, S1679), acetic acid 10mM (Sigma, AX0073), citric acid 10mM (Sigma, 27109), and HCl 5mM (Sigma, 109057).

    Article Title: A high-throughput genetic screening protocol to measure lipid bilayer stress-induced unfolded protein response in Saccharomyces cerevisiae
    Article Snippet: L-Glutamic acid monosodium salt hydrate (MSG) , Sigma-Aldrich , G1626.

    Article Title: Lactic Acid Fermented Green Tea with Levilactobacillus brevis Capable of Producing γ-Aminobutyric Acid
    Article Snippet: Briefly, 1 mL of the culture was transferred into 10 mL of MRS broth containing L-glutamic acid monosodium salt hydrate (MSG, Sigma, St. Louis, MO, USA) at a final concentration of 1% (w/v).

    Article Title: Cellular and neural responses to sour stimuli require the proton channel Otop1
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken anti-GFP Aves Labs Cat# GFP-1020 Guinea pig anti-TRPM5 [ 5 ] N/A Chemicals, Peptides, and Recombinant Proteins Elastase Worthington Biochemical Cat# {"type":"entrez-nucleotide","attrs":{"text":"LS002290","term_id":"1321652434","term_text":"LS002290"}} LS002290 Dispase II Sigma Cat# D4693 TransIT-LT1 transfection reagent Mirus Bio Corporation Cat# MIR2300 Urethane Sigam Cat# U2500 Saccharin Sigma Cat# 8.17042 L-Glutamic acid monosodium salt hydrate (MSG) Sigma Cat# G5889 inosine 5’-monophosphate (IMP) Sigma Cat# PHR1475 quinine hydrochloride dihydrate (QHCl) Sigma Cat# 1596807 amiloride Sigma Cat# A-7410 Acetic acid Sigma Cat# Ax0073 Citric acid Sigma Cat# 27109 HCl Sigma Cat# 109057 DIDS Fisher Scientific Cat# 45–235-0 Fura, AM, cell permeant ThermoFisher Cat# F1221 pHrodo red AM intracellular pH indicator ThermoFisher Cat# {"type":"entrez-protein","attrs":{"text":"P35372","term_id":"2851402","term_text":"P35372"}} P35372 Experimental Models: Cell Lines HEK-293 cells ATCC Cat# CRL-1573 Experimental Models: Organisms/Strains Xenopus laevis oocytes Ecocyte Bioscience RRID:SCR_014773 PKD2L1-YFP, Otop1 em1Lmn This paper N/A PKD2L1-YFP transgenic mice [ 33 ] N/A Oligonucleotides sgRNA for CRISPR-Cas9 mediated Otop1-KO mouse: CGCCGGGGACCGGAAGCTTG This Paper N/A Whole exon 1 genotyping forward: GGAGCCAGGAGCAACGTGC IDT N/A Whole exon 1 genotyping reverse: CTGCTCAGAGTCTCCGCCAGC IDT N/A WT-specific allele genotyping forward: TGGAGGAGAGCAGGATCTGAGG IDT N/A WT-specific allele genotyping reverse: AGTCTCCGCCAGCTTCTGCG IDT N/A Mutant (−38)-specific allele genotyping forward: TGGAGGAGAGCAGGATCTGAGG IDT N/A Mutant (−38)-specific allele genotyping reverse: GTCTCCGCCAGCTTCTGGA IDT N/A Recombinant DNA pGEMHE vector [ 59 ] N/A pcDNA3.1_Otop1 [ 34 ] N/A pX330-U6-Chimeric_BB-CBh-hSpCas9 Addgene Cat# 42230 Software and Algorithms pClamp and clampfit Molecular devices RRID:SCR_011323 GraphPad Prism 7 or 8 GraphPad RRID:SCR_002798 Origin OriginLab corporation RRID:SCR_002815 Matlab Mathworks RRID:SCR_001622 AcqKnowledge Software BIOPAC RRID:SCR_014279 CorelDraw Corel RRID:SCR_014235 SimplePCI HCImage https://hcimage.com/simple-pci-legacy/ Open in a separate window KEY RESOURCES TABLE Genetic inactivation of Otop1 in mice eliminates proton currents in taste cells Otop1-KO mice have severely attenuated cellular responses to acids Otop1-KO mice have severely attenuated gustatory nerve responses to acids Otop1 is a sour taste receptor

    Article Title: Prediabetic changes in gene expression induced by aspartame and monosodium glutamate in Trans fat-fed C57Bl/6 J mice
    Article Snippet: MSG + TFA diet : TFA diet with ad lib drinking water containing 0.75 g/L of L -Glutamic acid monosodium salt hydrate (MSG catalog G1626 Sigma Aldrich) [ ].



    Similar Products

    l-glutamic acid monosodium salt hydrate (monosodium glutamate, msg, g5889  (Millipore)
    90
    Millipore l-glutamic acid monosodium salt hydrate (monosodium glutamate, msg, g5889
    L Glutamic Acid Monosodium Salt Hydrate (Monosodium Glutamate, Msg, G5889, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/msg+(l-glutamic+acid+monosodium+salt+hydrate/l+glutamic+acid/pmc10224201-201-12-24
    Average 90 stars, based on 1 article reviews
    l-glutamic acid monosodium salt hydrate (monosodium glutamate, msg, g5889 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    l -glutamic acid monosodium salt hydrate (msg  (Millipore)
    90
    Millipore l -glutamic acid monosodium salt hydrate (msg
    L Glutamic Acid Monosodium Salt Hydrate (Msg, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/msg+(l-glutamic+acid+monosodium+salt+hydrate/l+glutamic+acid+monosodium+salt+hydrate/pmc03727955-162-16-25
    Average 90 stars, based on 1 article reviews
    l -glutamic acid monosodium salt hydrate (msg - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    l-glutamic acid monosodium salt hydrate (msg  (Millipore)
    90
    Millipore l-glutamic acid monosodium salt hydrate (msg

    L Glutamic Acid Monosodium Salt Hydrate (Msg, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/msg+(l-glutamic+acid+monosodium+salt+hydrate/l+glutamic+acid+monosodium+salt+hydrate/pmc08496318-26-0-7
    Average 90 stars, based on 1 article reviews
    l-glutamic acid monosodium salt hydrate (msg - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    l-glutamic acid monosodium salt hydrate (msg) 100mm  (Millipore)
    90
    Millipore l-glutamic acid monosodium salt hydrate (msg) 100mm
    (A) Representative chorda tympani nerve traces from WT (top) and Otop1-KO (bottom) mice. Tastants were applied for 30s, as indicated by the stimulus bars. Responses to acidic stimuli are highlighted in red in the Otop1-KO trace. Solutions were as follows: 100 mM NH4Cl (ammonium chloride), 200 mM NaCl (salt), 200 mM NaCl + 100 μM amiloride (amiloride-insensitive salt), 30 mM saccharin (sweet), 300 mM <t>MSG</t> + 0.5 mM IMP (umami), 10 mM quinine (bitter), 10 mM acetic acid, 10 mM citric acid, and 10 mM HCl (sour). (B) Chorda tympani nerve responses to a panel of taste solutions in both WT (n=4) and Otop1-KO (n=7) mice. Data from individual animals and the mean ± SEM are shown. All responses are normalized to the baseline 2 seconds before the stimulus. Amiloride-sensitive salt taste was calculated as the difference between responses to NaCl with and without amiloride. Corrected p values for comparisons between genotypes were: 100 mM NH4Cl (p = 0.6470); 200 mM NaCl + 100 μM amiloride, (p = 0.1064), amiloride-sensitive salt taste (p = 0.6470); 30 mM saccharin (p = 0.4968); 300 mM MSG + 0.5 mM IMP (p = 0.3902); 10 mM quinine (p = 0.0680); 10 mM acetic acid (p = 0.0306); 10 mM citric acid (p < 0.0001) and 10 mM HCl (p < 0.0001). <t>(C)</t> <t>Glossopharyngeal</t> nerve responses to a panel of taste solutions in both WT (n=5) and Otop1-KO (n=5) mice. Data from individual animals and the mean ± SEM are shown, normalized to the qunine response. Solutions and corrected p values for comparisons between genotypes were as follows: 100 mM NH4Cl (p = 0.0223), 100 mM NaCl (salt) (p = 0.3408), 20 mM saccharin (sweet) (p = 0.6464), 100 mM MSG + 1 mM IMP (umami) (p = 5704), 10 mM acetic acid (p = 0.3457), 10 mM citric acid (p = 0.0043), and 5 mM HCl (p = 0.0035). Error bars denote SEM. Statistical significance was determined by 2-way ANOVA with correction for false discover rate by two-stage step-up method of Bengamini, Krieger and Yekutiel. See also Figure S3.
    L Glutamic Acid Monosodium Salt Hydrate (Msg) 100mm, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/msg+(l-glutamic+acid+monosodium+salt+hydrate/sodium+bicarbonate/pmc07299528-665-12-19
    Average 90 stars, based on 1 article reviews
    l-glutamic acid monosodium salt hydrate (msg) 100mm - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    msg (l-glutamic acid monosodium salt hydrate  (Millipore)
    90
    Millipore msg (l-glutamic acid monosodium salt hydrate
    (A) Representative chorda tympani nerve traces from WT (top) and Otop1-KO (bottom) mice. Tastants were applied for 30s, as indicated by the stimulus bars. Responses to acidic stimuli are highlighted in red in the Otop1-KO trace. Solutions were as follows: 100 mM NH4Cl (ammonium chloride), 200 mM NaCl (salt), 200 mM NaCl + 100 μM amiloride (amiloride-insensitive salt), 30 mM saccharin (sweet), 300 mM <t>MSG</t> + 0.5 mM IMP (umami), 10 mM quinine (bitter), 10 mM acetic acid, 10 mM citric acid, and 10 mM HCl (sour). (B) Chorda tympani nerve responses to a panel of taste solutions in both WT (n=4) and Otop1-KO (n=7) mice. Data from individual animals and the mean ± SEM are shown. All responses are normalized to the baseline 2 seconds before the stimulus. Amiloride-sensitive salt taste was calculated as the difference between responses to NaCl with and without amiloride. Corrected p values for comparisons between genotypes were: 100 mM NH4Cl (p = 0.6470); 200 mM NaCl + 100 μM amiloride, (p = 0.1064), amiloride-sensitive salt taste (p = 0.6470); 30 mM saccharin (p = 0.4968); 300 mM MSG + 0.5 mM IMP (p = 0.3902); 10 mM quinine (p = 0.0680); 10 mM acetic acid (p = 0.0306); 10 mM citric acid (p < 0.0001) and 10 mM HCl (p < 0.0001). <t>(C)</t> <t>Glossopharyngeal</t> nerve responses to a panel of taste solutions in both WT (n=5) and Otop1-KO (n=5) mice. Data from individual animals and the mean ± SEM are shown, normalized to the qunine response. Solutions and corrected p values for comparisons between genotypes were as follows: 100 mM NH4Cl (p = 0.0223), 100 mM NaCl (salt) (p = 0.3408), 20 mM saccharin (sweet) (p = 0.6464), 100 mM MSG + 1 mM IMP (umami) (p = 5704), 10 mM acetic acid (p = 0.3457), 10 mM citric acid (p = 0.0043), and 5 mM HCl (p = 0.0035). Error bars denote SEM. Statistical significance was determined by 2-way ANOVA with correction for false discover rate by two-stage step-up method of Bengamini, Krieger and Yekutiel. See also Figure S3.
    Msg (L Glutamic Acid Monosodium Salt Hydrate, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/msg+(l-glutamic+acid+monosodium+salt+hydrate/l+glutamic+acid+monosodium+salt+hydrate/pm32042309-39-28-34
    Average 90 stars, based on 1 article reviews
    msg (l-glutamic acid monosodium salt hydrate - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: STAR Protocols

    Article Title: A high-throughput genetic screening protocol to measure lipid bilayer stress-induced unfolded protein response in Saccharomyces cerevisiae

    doi: 10.1016/j.xpro.2021.100868

    Figure Lengend Snippet:

    Article Snippet: L-Glutamic acid monosodium salt hydrate (MSG) , Sigma-Aldrich , G1626.

    Techniques: Recombinant, Clone Assay, Software, Microscopy

    (A) Representative chorda tympani nerve traces from WT (top) and Otop1-KO (bottom) mice. Tastants were applied for 30s, as indicated by the stimulus bars. Responses to acidic stimuli are highlighted in red in the Otop1-KO trace. Solutions were as follows: 100 mM NH4Cl (ammonium chloride), 200 mM NaCl (salt), 200 mM NaCl + 100 μM amiloride (amiloride-insensitive salt), 30 mM saccharin (sweet), 300 mM MSG + 0.5 mM IMP (umami), 10 mM quinine (bitter), 10 mM acetic acid, 10 mM citric acid, and 10 mM HCl (sour). (B) Chorda tympani nerve responses to a panel of taste solutions in both WT (n=4) and Otop1-KO (n=7) mice. Data from individual animals and the mean ± SEM are shown. All responses are normalized to the baseline 2 seconds before the stimulus. Amiloride-sensitive salt taste was calculated as the difference between responses to NaCl with and without amiloride. Corrected p values for comparisons between genotypes were: 100 mM NH4Cl (p = 0.6470); 200 mM NaCl + 100 μM amiloride, (p = 0.1064), amiloride-sensitive salt taste (p = 0.6470); 30 mM saccharin (p = 0.4968); 300 mM MSG + 0.5 mM IMP (p = 0.3902); 10 mM quinine (p = 0.0680); 10 mM acetic acid (p = 0.0306); 10 mM citric acid (p < 0.0001) and 10 mM HCl (p < 0.0001). (C) Glossopharyngeal nerve responses to a panel of taste solutions in both WT (n=5) and Otop1-KO (n=5) mice. Data from individual animals and the mean ± SEM are shown, normalized to the qunine response. Solutions and corrected p values for comparisons between genotypes were as follows: 100 mM NH4Cl (p = 0.0223), 100 mM NaCl (salt) (p = 0.3408), 20 mM saccharin (sweet) (p = 0.6464), 100 mM MSG + 1 mM IMP (umami) (p = 5704), 10 mM acetic acid (p = 0.3457), 10 mM citric acid (p = 0.0043), and 5 mM HCl (p = 0.0035). Error bars denote SEM. Statistical significance was determined by 2-way ANOVA with correction for false discover rate by two-stage step-up method of Bengamini, Krieger and Yekutiel. See also Figure S3.

    Journal: Current biology : CB

    Article Title: Cellular and neural responses to sour stimuli require the proton channel Otop1

    doi: 10.1016/j.cub.2019.08.077

    Figure Lengend Snippet: (A) Representative chorda tympani nerve traces from WT (top) and Otop1-KO (bottom) mice. Tastants were applied for 30s, as indicated by the stimulus bars. Responses to acidic stimuli are highlighted in red in the Otop1-KO trace. Solutions were as follows: 100 mM NH4Cl (ammonium chloride), 200 mM NaCl (salt), 200 mM NaCl + 100 μM amiloride (amiloride-insensitive salt), 30 mM saccharin (sweet), 300 mM MSG + 0.5 mM IMP (umami), 10 mM quinine (bitter), 10 mM acetic acid, 10 mM citric acid, and 10 mM HCl (sour). (B) Chorda tympani nerve responses to a panel of taste solutions in both WT (n=4) and Otop1-KO (n=7) mice. Data from individual animals and the mean ± SEM are shown. All responses are normalized to the baseline 2 seconds before the stimulus. Amiloride-sensitive salt taste was calculated as the difference between responses to NaCl with and without amiloride. Corrected p values for comparisons between genotypes were: 100 mM NH4Cl (p = 0.6470); 200 mM NaCl + 100 μM amiloride, (p = 0.1064), amiloride-sensitive salt taste (p = 0.6470); 30 mM saccharin (p = 0.4968); 300 mM MSG + 0.5 mM IMP (p = 0.3902); 10 mM quinine (p = 0.0680); 10 mM acetic acid (p = 0.0306); 10 mM citric acid (p < 0.0001) and 10 mM HCl (p < 0.0001). (C) Glossopharyngeal nerve responses to a panel of taste solutions in both WT (n=5) and Otop1-KO (n=5) mice. Data from individual animals and the mean ± SEM are shown, normalized to the qunine response. Solutions and corrected p values for comparisons between genotypes were as follows: 100 mM NH4Cl (p = 0.0223), 100 mM NaCl (salt) (p = 0.3408), 20 mM saccharin (sweet) (p = 0.6464), 100 mM MSG + 1 mM IMP (umami) (p = 5704), 10 mM acetic acid (p = 0.3457), 10 mM citric acid (p = 0.0043), and 5 mM HCl (p = 0.0035). Error bars denote SEM. Statistical significance was determined by 2-way ANOVA with correction for false discover rate by two-stage step-up method of Bengamini, Krieger and Yekutiel. See also Figure S3.

    Article Snippet: Taste solutions used for glossopharyngeal nerve recordings are: Saccharin 20mM (Sigma, 8.17042), L-Glutamic acid monosodium salt hydrate (MSG) 100mM (Sigma, G5889), inosine 5’-monophosphate (IMP) 1mM (Sigma, PHR1475), quinine hydrochloride dihydrate (QHCl) 0.3mM (Sigma, 1596807), NH4Cl 100mM (Sigma, 11209), NaCl 100mM (Sigma, S1679), acetic acid 10mM (Sigma, AX0073), citric acid 10mM (Sigma, 27109), and HCl 5mM (Sigma, 109057).

    Techniques:

    KEY RESOURCES TABLE

    Journal: Current biology : CB

    Article Title: Cellular and neural responses to sour stimuli require the proton channel Otop1

    doi: 10.1016/j.cub.2019.08.077

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Taste solutions used for glossopharyngeal nerve recordings are: Saccharin 20mM (Sigma, 8.17042), L-Glutamic acid monosodium salt hydrate (MSG) 100mM (Sigma, G5889), inosine 5’-monophosphate (IMP) 1mM (Sigma, PHR1475), quinine hydrochloride dihydrate (QHCl) 0.3mM (Sigma, 1596807), NH4Cl 100mM (Sigma, 11209), NaCl 100mM (Sigma, S1679), acetic acid 10mM (Sigma, AX0073), citric acid 10mM (Sigma, 27109), and HCl 5mM (Sigma, 109057).

    Techniques: Recombinant, Transfection, Transgenic Assay, CRISPR, Mutagenesis, Plasmid Preparation, Software